View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15982_low_62 (Length: 234)
Name: NF15982_low_62
Description: NF15982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15982_low_62 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 11480182 - 11479982
Alignment:
| Q |
20 |
caacataacttcatcaacaacgatagttgatgtggttaaccataatttacgagttttgatggagatcatttgaacatctaaaaaattatggttaatcatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11480182 |
caacataacttcatcaacaacgatagttgatgtggttaaccataatttacgagttttgatggagatcatttgaacatctaaaaaattatggttaatcacg |
11480083 |
T |
|
| Q |
120 |
tcgaaatatgtcttttnnnnnnncacgtttatatttgttgttgatgaaaatacaatgatggttagtaaatataaatttattattcttttacttagtataa |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||| |||| ||||||||||||||||||||||||| |||| |
|
|
| T |
11480082 |
tcgaaatatgtcttttaaaaaaacacgtttatatttgttgttgatgaagaaacaatgatggttaataaagataaatttattattcttttacttagcataa |
11479983 |
T |
|
| Q |
220 |
t |
220 |
Q |
| |
|
| |
|
|
| T |
11479982 |
t |
11479982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University