View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15983_low_8 (Length: 202)
Name: NF15983_low_8
Description: NF15983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15983_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 20 - 187
Target Start/End: Original strand, 58945 - 59109
Alignment:
| Q |
20 |
attgtccttgtagtcgtcaatattgcaaattctttcnnnnnnnctttctctcaataaaggatatttgataaagagatgcaaaatatagaagaagaaaatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
58945 |
attgtccttgtagtcgtcaatattgcaaattctttcttttt---tttctctcaataaaggatatctgataaagagatgcaaaatatagaagaagaaaatg |
59041 |
T |
 |
| Q |
120 |
atatcctcctaatgaaaccactgaccaaaagaaggatatcaaggagaattatcatgccaatccctatg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
59042 |
atatcctcctaatgaaaccactgaccaaaagaaggatatcaaggagaattattgtgccaatccctatg |
59109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University