View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15984_high_37 (Length: 231)
Name: NF15984_high_37
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15984_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 34832723 - 34832520
Alignment:
| Q |
18 |
gtattgaattttgtttgtgagtattgtcgaggaaat----ggtttacccacttcctgatgagtgtgtaatattatcaagatcttgggtcgggataatttt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
34832723 |
gtattgaattttgtttgtgagtattgtcgaggaaataaatggtttacccacttcctaatgagtgt--aatatcatcaagatcttgggtcgggataatttt |
34832626 |
T |
 |
| Q |
114 |
aattttgcgctatatttaagtcttttttgaggggttttgaagccaaaattgaaattcttgttcaactaattccatcaaaatacttgttgccctaaatgat |
213 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34832625 |
aattttgcgctatattttagtcttttt-gagtggttttgaagccaaaattgaaattcttgttcaactaattccatcaaaatacttgttgccctaaatgat |
34832527 |
T |
 |
| Q |
214 |
tcttctc |
220 |
Q |
| |
|
||||||| |
|
|
| T |
34832526 |
tcttctc |
34832520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University