View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15984_high_37 (Length: 231)

Name: NF15984_high_37
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15984_high_37
NF15984_high_37
[»] chr2 (1 HSPs)
chr2 (18-220)||(34832520-34832723)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 34832723 - 34832520
Alignment:
18 gtattgaattttgtttgtgagtattgtcgaggaaat----ggtttacccacttcctgatgagtgtgtaatattatcaagatcttgggtcgggataatttt 113  Q
    ||||||||||||||||||||||||||||||||||||    |||||||||||||||| ||||||||  ||||| |||||||||||||||||||||||||||    
34832723 gtattgaattttgtttgtgagtattgtcgaggaaataaatggtttacccacttcctaatgagtgt--aatatcatcaagatcttgggtcgggataatttt 34832626  T
114 aattttgcgctatatttaagtcttttttgaggggttttgaagccaaaattgaaattcttgttcaactaattccatcaaaatacttgttgccctaaatgat 213  Q
    ||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34832625 aattttgcgctatattttagtcttttt-gagtggttttgaagccaaaattgaaattcttgttcaactaattccatcaaaatacttgttgccctaaatgat 34832527  T
214 tcttctc 220  Q
    |||||||    
34832526 tcttctc 34832520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University