View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15984_low_13 (Length: 395)
Name: NF15984_low_13
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15984_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 80 - 377
Target Start/End: Complemental strand, 44515692 - 44515386
Alignment:
| Q |
80 |
tgtcttccactcatttgcataagaaaccacaggtagtccagtatatttgaaggccttttcagtcggaatgccattatctcttatagtacgaagtacttcc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44515692 |
tgtcttccactcatttgcataagaaaccacaggtagtccagtatatttgaaggccttttcagtcggaatgccactatctcttatagtacgaagtacttcc |
44515593 |
T |
 |
| Q |
180 |
tcacaagtaaagccaccaaccacatcctcaatg---------tgtatattaccttcactcgttttacacattccctccaaccgttgacgtgcaaaacggt |
270 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515592 |
tcgcaagtaaagccaccaaccacatcctcaatgcactcaatgtgtatattaccttcactcattttacacattccctccaaccgttgacgtgcaaaacggt |
44515493 |
T |
 |
| Q |
271 |
ttactgcgtattgtgtagaaagctcaattggatcttcaggcctaagggcgcaattgatcacgctttcaacacaagaaacaacaccaaaaatagaacagac |
370 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515492 |
ttactacgtattgtgtagaaagctcaattggatcttcaggcctaagggcgcaattgatcacgctttcaacacaagaaacaacaccaaaaatagaacagac |
44515393 |
T |
 |
| Q |
371 |
ccctgtt |
377 |
Q |
| |
|
||||||| |
|
|
| T |
44515392 |
ccctgtt |
44515386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University