View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15984_low_18 (Length: 352)
Name: NF15984_low_18
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15984_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 335; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 343
Target Start/End: Original strand, 45929999 - 45930341
Alignment:
| Q |
1 |
acggatagtccattcattatatcacctagaattacttttgaggtcagtgtgcgtcttcttggagggctgatggccttggggtatacaattgcagcaatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45929999 |
acggatagtccattcattatatcacctagaattacttttgaggtcagtgtgcgtcttcttggagggctgatggccttggggtatacaattgcagcaatcc |
45930098 |
T |
|
| Q |
101 |
tgaaaagaagcagccatgtctttcacgatgataaagtatccataaaaactgactggcttgaacagcttaatcgccaatatgtccaggtacaacagcatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45930099 |
tgaaaagaagcagccatgtctttcacgatgataaagtatccataaaaactgactggctcgaacagcttaatcgccaatatgtccaggtacaacagcatat |
45930198 |
T |
|
| Q |
201 |
tgtttgtatctctcccttcttacttttttctatgcttaatcgtcaatattgtctggtacaaaagaaattccaatactagcttgaccctcacaacccgctc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45930199 |
tgtttgtatctctcccttcttacttttttctatgcttaatcgtcaatattgtctggtacaaaagaaattccaatactagctcgaccctcacaacccgctc |
45930298 |
T |
|
| Q |
301 |
ttttccctctattcttttgttgagtgttgtcttccattcatat |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45930299 |
ttttccctctattcttttgttgagtgttgtcttccattcatat |
45930341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 19 - 123
Target Start/End: Original strand, 28076134 - 28076238
Alignment:
| Q |
19 |
atatcacctagaattacttttgaggtcagtgtgcgtcttcttggagggctgatggccttggggtatacaattgcagcaatcctgaaaagaagcagccatg |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| || ||||| || || ||||||||||| ||||| || || | ||||| || |||| ||| |||| |
|
|
| T |
28076134 |
atatcaccgagaattacttttgaggtcagtgtgcgcctccttggtggactaatggccttgggatatacgatagctactatccttaagagaaacagtcatg |
28076233 |
T |
|
| Q |
119 |
tcttt |
123 |
Q |
| |
|
||||| |
|
|
| T |
28076234 |
tcttt |
28076238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 122
Target Start/End: Original strand, 29536842 - 29536945
Alignment:
| Q |
19 |
atatcacctagaattacttttgaggtcagtgtgcgtcttcttggagggctgatggccttggggtatacaattgcagcaatcctgaaaagaagcagccatg |
118 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||| || ||||||||| | || || ||||| ||| | || || |||||||| ||||||| |
|
|
| T |
29536842 |
atatcaccgagaattacttttgcggtcagtgtgcgtcttcttggtggactgatggcccttggatacacaatagcaactattcttaaaagaagtagccatg |
29536941 |
T |
|
| Q |
119 |
tctt |
122 |
Q |
| |
|
|||| |
|
|
| T |
29536942 |
tctt |
29536945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University