View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15984_low_27 (Length: 288)
Name: NF15984_low_27
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15984_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 268
Target Start/End: Original strand, 34219331 - 34219584
Alignment:
| Q |
13 |
tattatactagagataattagtggaaacaagaacagggaatattgtgactatcatggccttgatcttcttggatatgtaagtctaaggctttaacccact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34219331 |
tattatactagagataattagtggaaacaagaacagggaatattgtgactatcatggccttgatcttcttggatatgtaagtctaaggctttaacccact |
34219430 |
T |
|
| Q |
113 |
taaaagtgttgtcatgcagatcgtaaaaactactgatttgttcaaagttcgctactctacggtgctatagtgatgttacagctgctatttaacaacacta |
212 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34219431 |
taaaagggttgtcatgcagatcgtaagaactactgatttgttcaaagttcactactctacggtgctatagtgatgttacagctgctatttaacaacac-- |
34219528 |
T |
|
| Q |
213 |
tatattaaatcacattcaagaacaataatcgtttgtaaaaattcggctatgctttg |
268 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
34219529 |
tatattaaatcacattcaagaacaatagtagtttgtaaaaattcggctatgctttg |
34219584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 13 - 105
Target Start/End: Complemental strand, 34192325 - 34192233
Alignment:
| Q |
13 |
tattatactagagataattagtggaaacaagaacagggaatattgtgactatcatggccttgatcttcttggatatgtaagtctaaggcttta |
105 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
34192325 |
tattatactagagacaattagtggaaacaagaaccgggaatattgtgactatgatgatcttgatcttcttggatatgtaagtctaaggattta |
34192233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 13 - 94
Target Start/End: Original strand, 34208175 - 34208256
Alignment:
| Q |
13 |
tattatactagagataattagtggaaacaagaacagggaatattgtgactatcatggccttgatcttcttggatatgtaagt |
94 |
Q |
| |
|
|||||||||||||| ||| | |||||| ||||||||||||||| ||||| |||||| ||||| |||||||||||||||||| |
|
|
| T |
34208175 |
tattatactagagacaataactggaaaaaagaacagggaatatagtgaccatcatgatcttgaccttcttggatatgtaagt |
34208256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University