View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15984_low_29 (Length: 270)
Name: NF15984_low_29
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15984_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 51 - 220
Target Start/End: Original strand, 10193246 - 10193415
Alignment:
| Q |
51 |
atattaactaagcttattccactaacttgatcagttagttaagtacaccctcagtggtgtagaccacacatagcttaccaaaaaccatgtaactaaaaat |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10193246 |
atattaactaagcttattccactaacttgatcagttagttaagtacaccctcagtggtgtagaccacacatagcttaccaaaagccatgtaactaaaaat |
10193345 |
T |
|
| Q |
151 |
tgacttgttaagtacacgaagcttgtgtgcagcttaactggtcaaccctaaaaattgacttttaaggtga |
220 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10193346 |
tgacttgttaagtacatgaagcttgtgtgcagcttaactggtcaaccctaaaaattgacttgtaaggtga |
10193415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 188 - 220
Target Start/End: Complemental strand, 19459820 - 19459788
Alignment:
| Q |
188 |
ctggtcaaccctaaaaattgacttttaaggtga |
220 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
19459820 |
ctggtcaaccctaaaaattgacttgtaaggtga |
19459788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University