View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15984_low_34 (Length: 252)

Name: NF15984_low_34
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15984_low_34
NF15984_low_34
[»] chr8 (3 HSPs)
chr8 (122-243)||(7034979-7035100)
chr8 (9-64)||(7035151-7035206)
chr8 (15-56)||(7028415-7028456)


Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 122 - 243
Target Start/End: Complemental strand, 7035100 - 7034979
Alignment:
122 gactttaaattatagctgcattcaacaagctagatatcagattaagccctgttgatgacttgactaatgagtaccgacttagtccagtcaatattacagt 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7035100 gactttaaattatagctgcattcaacaagctagatatcagattaagccctgttgatgacttgactaatgagtaccgacttagtccagtcaatattacagt 7035001  T
222 tatgttgctatcttcttcttct 243  Q
    ||||||||||||||||||||||    
7035000 tatgttgctatcttcttcttct 7034979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 9 - 64
Target Start/End: Complemental strand, 7035206 - 7035151
Alignment:
9 agcataaagagagtgagataaacaaataaacttatgctactactggatatctgcat 64  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
7035206 agcataaagagagtgagataaacaaataaacttatgctactacaggatatctgcat 7035151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 15 - 56
Target Start/End: Complemental strand, 7028456 - 7028415
Alignment:
15 aagagagtgagataaacaaataaacttatgctactactggat 56  Q
    |||||||||||||||| ||| |||||||||||||||||||||    
7028456 aagagagtgagataaagaaacaaacttatgctactactggat 7028415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University