View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15984_low_34 (Length: 252)
Name: NF15984_low_34
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15984_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 122 - 243
Target Start/End: Complemental strand, 7035100 - 7034979
Alignment:
| Q |
122 |
gactttaaattatagctgcattcaacaagctagatatcagattaagccctgttgatgacttgactaatgagtaccgacttagtccagtcaatattacagt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7035100 |
gactttaaattatagctgcattcaacaagctagatatcagattaagccctgttgatgacttgactaatgagtaccgacttagtccagtcaatattacagt |
7035001 |
T |
 |
| Q |
222 |
tatgttgctatcttcttcttct |
243 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7035000 |
tatgttgctatcttcttcttct |
7034979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 9 - 64
Target Start/End: Complemental strand, 7035206 - 7035151
Alignment:
| Q |
9 |
agcataaagagagtgagataaacaaataaacttatgctactactggatatctgcat |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7035206 |
agcataaagagagtgagataaacaaataaacttatgctactacaggatatctgcat |
7035151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 15 - 56
Target Start/End: Complemental strand, 7028456 - 7028415
Alignment:
| Q |
15 |
aagagagtgagataaacaaataaacttatgctactactggat |
56 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7028456 |
aagagagtgagataaagaaacaaacttatgctactactggat |
7028415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University