View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15984_low_36 (Length: 243)
Name: NF15984_low_36
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15984_low_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 41742371 - 41742583
Alignment:
| Q |
19 |
gagttaagtctcgagaggtctaggatttatgaacttaaaggggtaattttaaaattttgagggacctgttagcatctagaggtgcctatttatcaaattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
41742371 |
gagttaagtctcgagaggtctaggatttatgaacttataggggtaattttaaaattttgagggacctgtgagcatctagaggtgcctattgatcaaattt |
41742470 |
T |
 |
| Q |
119 |
ctttaaagaaatcgcaaagatgttaacaggtgtgtgatgacgacgaagagataaacttataaagattagtaattcacaatattaacaacttaaacatgaa |
218 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41742471 |
cttcaaagaaatcgcaaagatgttaacaggtgtgtgacgacgacgaagagataaacttataaagattagtaattcacaatattaacaacttaaacatgaa |
41742570 |
T |
 |
| Q |
219 |
aattttaccctat |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41742571 |
aattttaccctat |
41742583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University