View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15984_low_38 (Length: 236)
Name: NF15984_low_38
Description: NF15984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15984_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 11 - 129
Target Start/End: Original strand, 8923956 - 8924075
Alignment:
| Q |
11 |
cgaagaatatcaactatcaaagacaaagattatgacattata-ttttttacttcattatcctattataannnnnnnatgaccgaaagttttaagtgagtt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8923956 |
cgaacaatatcaactatcaaagacaaagattatgacattatatttttttatttcattatcctattataatttttttatgaccgaaagttttaagtgagtt |
8924055 |
T |
 |
| Q |
110 |
gcaaggccgcaaatagtaag |
129 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
8924056 |
gcaaggccgcaaatagtaag |
8924075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University