View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15985_high_10 (Length: 316)
Name: NF15985_high_10
Description: NF15985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15985_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 9303374 - 9303675
Alignment:
| Q |
1 |
cttctcctatctggtcatgctctagttgctactccatctttcacctcaactgtacaaccaagtgggctcgtgcaccaacttcatcatcccaaactagcat |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9303374 |
cttcccctatctggtcatgctctagttgctactccatctttcacctcaactgtacaaccaagtgggctcgtgcaccaacttcatcatcccaaactagcat |
9303473 |
T |
|
| Q |
101 |
tgattggcgctgccccggctgtcaatctgtgcaactcacctcatccaattccatcaggtacttttgcttttgtgggaagacacccgaccctgcatctgac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9303474 |
tgattggcgctgccccggctgtcaatctgtgcaactcacctcatccaattccatcaggtacttttgcttttgtgggaagacacctgaccctgcatctgac |
9303573 |
T |
|
| Q |
201 |
ttttatctcacgccacattcatgtggagaaccttgtgggaagcctcttcagaagacgggggatctttgccctcatgtttgtgtcttgcaatgccatcctg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9303574 |
ttttatctcacgccacattcatgtggagaaccttgtgggaagcctcttcaaaagacgggggatctttgccctcatgtttgtgtcttgcaatgtcatcctg |
9303673 |
T |
|
| Q |
301 |
gt |
302 |
Q |
| |
|
|| |
|
|
| T |
9303674 |
gt |
9303675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 298
Target Start/End: Original strand, 26283605 - 26283639
Alignment:
| Q |
264 |
ctttgccctcatgtttgtgtcttgcaatgccatcc |
298 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26283605 |
ctttgccctcatgcttgtgtcttgcaatgccatcc |
26283639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 6 - 46
Target Start/End: Original strand, 26283308 - 26283348
Alignment:
| Q |
6 |
cctatctggtcatgctctagttgctactccatctttcacct |
46 |
Q |
| |
|
||||||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
26283308 |
cctatctggtcttgctccagttgctactctatctttcacct |
26283348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University