View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15985_low_13 (Length: 247)
Name: NF15985_low_13
Description: NF15985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15985_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 31216931 - 31216705
Alignment:
| Q |
1 |
tataaaccattggttgatgagaacgtgcatggcatgataggaaacgacaacaaccaaattttgttggttagtacatcctagtcatcacaacaagatacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31216931 |
tataaaccattggttgatgagaacgtgcatggcatgataggaaacgacaacaaccaaattttgttggttagtacatcctagtcatcacaacaagatacgt |
31216832 |
T |
|
| Q |
101 |
gttgcttaacttatgggccacattattgaatatatggatcaatgaacagaaacaaaatcagggtacatctcacatggttatgcccccttgccctttggag |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31216831 |
gttacttaacttatgggccacattattgaatatatggatcaatgaacagaaacaaaatcagggtacatctcacatggttatgcccccttgccctttggag |
31216732 |
T |
|
| Q |
201 |
atataatagatagatatagattcatttgt |
229 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
31216731 |
atataatagatag--atagattcatttgt |
31216705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University