View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_high_14 (Length: 394)
Name: NF15986_high_14
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 264
Target Start/End: Complemental strand, 8022434 - 8022184
Alignment:
| Q |
14 |
cagagaaacagggtgttggaagcacaaaacatgcttctgctgaacatgttttggttggtttgttaaatgctagagatcatgtcaaccatgatgtccatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022434 |
cagagaaacagggtgttggaagcacaaaacatgcttctgctgaacatgttttggttggtttgctaaatgctagagatcatgtcaaccatgatgtccatca |
8022335 |
T |
 |
| Q |
114 |
taggctatggaagcctgttttacaaagtattcctgagcttaattaattaggttcaaaattggtggtggtggggtgtgtatagtagaagttggttgagaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022334 |
taggctatggaagcctgttttacaaagtattcctgagcttaattaattaggttcaaaattggtggtggtggggtgtgtatagtagaagttggttgagaaa |
8022235 |
T |
 |
| Q |
214 |
agtttaggaagtttgtacttgtacaaaatcagaactaagctatactcaaca |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022234 |
agtttaggaagtttgtacttgtacaaaatcagaactaagctatactcaaca |
8022184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 317 - 375
Target Start/End: Complemental strand, 8022131 - 8022073
Alignment:
| Q |
317 |
gtaagatatatatagagtttgagaatgtcttatttctatatttttatgattgtacatag |
375 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
8022131 |
gtaagatatatatagaggttgagaatgtgttatttctatatttttatgattgtatatag |
8022073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University