View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_high_19 (Length: 367)
Name: NF15986_high_19
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 18 - 357
Target Start/End: Complemental strand, 14582625 - 14582286
Alignment:
| Q |
18 |
ggtttgccatgctataacaaaagcttctgatcctttggagaaaaatgcttaattatttgcttctgctactcagaaaaaagcataatccctttgtgatatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582625 |
ggtttgccatgctataacaaaagcttctgatcctttggagaaaaatgcttaattatttgcttctgctactcagaaaaaagcataatccctttgtgatatg |
14582526 |
T |
 |
| Q |
118 |
agaagccaaaagctaaagcacaaagcaaactgtttaggaaaatggagggagagtgtgtagggtttttgtttaataccctctcacacttctctccatgttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582525 |
agaagccaaaagctaaagcacaaagcaaactgtttaggaaaatggagggagagtgtgtagggtttttgtttaataccctctcacacttctctccatgttt |
14582426 |
T |
 |
| Q |
218 |
gttttaagaaccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaagtcttgatggattggtttagaggatgcttaaag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582425 |
gttttaagaaccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaagtcttgatggattggtttagaggatgcttaaag |
14582326 |
T |
 |
| Q |
318 |
ggctccacatagaaaggtagtggggaagttggtgtctctg |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582325 |
ggctccacatagaaaggtagtggggaagttggtgtctctg |
14582286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University