View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_high_34 (Length: 279)
Name: NF15986_high_34
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 20 - 266
Target Start/End: Complemental strand, 41937861 - 41937615
Alignment:
| Q |
20 |
aattataggaaaaatatatattgacggactaaattgaccaaccctaacagcttcaaggactaaaatgctaagtcattcaaatactcacaagcagtctatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41937861 |
aattataggaaaaatatatattgacggactaaattgaccaaccctaacagcttcaaggactaaaatgctaagtcattcaaatactcacaagcagtctacc |
41937762 |
T |
|
| Q |
120 |
aaacttaaaaatagaatcaaaagcacaaccaacactaaactttacctatcagttgctgcaatagaaccaaaacatacgcgttgattaaagtataagtcag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41937761 |
aaacttaaaaatagaatcaaaagcacaaccaacactaaactttacctatcagttgctgcaatagaaccaaaacatacgcgttgattaaagtataagtcag |
41937662 |
T |
|
| Q |
220 |
ggaatgagtgatcaataacacaagaattttgcaatataaagtggtct |
266 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41937661 |
gcaatgagtgatcaataacacaagaattttgcaatataaagtggtct |
41937615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 40 - 88
Target Start/End: Complemental strand, 11567619 - 11567571
Alignment:
| Q |
40 |
ttgacggactaaattgaccaaccctaacagcttcaaggactaaaatgct |
88 |
Q |
| |
|
|||| |||||||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
11567619 |
ttgagggactaaattgaccgacccttacaatttcaaggactaaaatgct |
11567571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University