View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15986_high_38 (Length: 252)

Name: NF15986_high_38
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15986_high_38
NF15986_high_38
[»] chr7 (2 HSPs)
chr7 (11-236)||(37580737-37580962)
chr7 (40-69)||(37466497-37466526)
[»] chr4 (1 HSPs)
chr4 (155-203)||(55118878-55118926)
[»] chr1 (1 HSPs)
chr1 (155-234)||(45071735-45071811)


Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 37580737 - 37580962
Alignment:
11 gcaaaggctagttctgatgatcttaattgttgggatgctgatttcgttaaggttgataacgctatgcttttggagtctgcgagttccaatgatcttgagg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
37580737 gcaaaggctagttctgatgatcttaattgttgggatgctgatttcgttaaggttgataaggctatgcttttggagtctgcgagttccaatgatcttgagg 37580836  T
111 ttcagaagaatgtggaagcaggctgggacgctgcggtgagtttggatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcaggctatgct 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37580837 ttcagaagaatgtggaagcaggctgggacgctgcggtgagtttggatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcaggctatgct 37580936  T
211 tttcgaactcattcaagctgcaaatt 236  Q
    ||||||||||||||||||||||||||    
37580937 tttcgaactcattcaagctgcaaatt 37580962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 69
Target Start/End: Complemental strand, 37466526 - 37466497
Alignment:
40 ttgggatgctgatttcgttaaggttgataa 69  Q
    ||||||||||||||||||||||||||||||    
37466526 ttgggatgctgatttcgttaaggttgataa 37466497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 55118878 - 55118926
Alignment:
155 gatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcagg 203  Q
    |||||||| ||||||||||||||||||||||||||||| ||||||||||    
55118878 gatgatctcaaggcttgggacgctgaattcatgaagcaggttgatcagg 55118926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 155 - 234
Target Start/End: Complemental strand, 45071811 - 45071735
Alignment:
155 gatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcaggctatgcttttcgaactcattcaagctgcaaa 234  Q
    ||||||||||||  |||||| ||||||||| |||||   ||||||||||||| |||||| || |||||||  ||||||||    
45071811 gatgatcttaagaattgggatgctgaattcgtgaag---gttgatcaggctacgctttttgacctcattcttgctgcaaa 45071735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University