View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_high_38 (Length: 252)
Name: NF15986_high_38
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 37580737 - 37580962
Alignment:
| Q |
11 |
gcaaaggctagttctgatgatcttaattgttgggatgctgatttcgttaaggttgataacgctatgcttttggagtctgcgagttccaatgatcttgagg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37580737 |
gcaaaggctagttctgatgatcttaattgttgggatgctgatttcgttaaggttgataaggctatgcttttggagtctgcgagttccaatgatcttgagg |
37580836 |
T |
|
| Q |
111 |
ttcagaagaatgtggaagcaggctgggacgctgcggtgagtttggatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcaggctatgct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37580837 |
ttcagaagaatgtggaagcaggctgggacgctgcggtgagtttggatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcaggctatgct |
37580936 |
T |
|
| Q |
211 |
tttcgaactcattcaagctgcaaatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37580937 |
tttcgaactcattcaagctgcaaatt |
37580962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 69
Target Start/End: Complemental strand, 37466526 - 37466497
Alignment:
| Q |
40 |
ttgggatgctgatttcgttaaggttgataa |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37466526 |
ttgggatgctgatttcgttaaggttgataa |
37466497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 55118878 - 55118926
Alignment:
| Q |
155 |
gatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcagg |
203 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55118878 |
gatgatctcaaggcttgggacgctgaattcatgaagcaggttgatcagg |
55118926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 155 - 234
Target Start/End: Complemental strand, 45071811 - 45071735
Alignment:
| Q |
155 |
gatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcaggctatgcttttcgaactcattcaagctgcaaa |
234 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||||| ||||||||||||| |||||| || ||||||| |||||||| |
|
|
| T |
45071811 |
gatgatcttaagaattgggatgctgaattcgtgaag---gttgatcaggctacgctttttgacctcattcttgctgcaaa |
45071735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University