View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_high_45 (Length: 238)
Name: NF15986_high_45
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_high_45 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0011 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 49371 - 49573
Alignment:
| Q |
15 |
cagagatctcttctagtcaaattactagttgaggcataaacagctgtgaagaaaaggaggttactattatttacaagaaggttaaaagtgacttgttgag |
114 |
Q |
| |
|
||||||||||||||||| ||||||||||| || ||||| |||||||||||| ||||||| || ||||| |||||||||||| |||||||||||||||| |
|
|
| T |
49371 |
cagagatctcttctagttaaattactagtagaagcatagacagctgtgaagcaaaggagattgctatt---tacaagaaggttgaaagtgacttgttgag |
49467 |
T |
 |
| Q |
115 |
tatctttatcaataacatgagggttaaggtcagaggaacaaaagcaccaaagattaggcttaagatttcctctttcattgaaggaaaaaagcttaaaccc |
214 |
Q |
| |
|
||| |||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49468 |
catccttatcaataacatgagggttaaggtcagttgcacaaaaacaccaaagattaggcttaagatttcctctttcattgaaggaaaaaagcttaaatcc |
49567 |
T |
 |
| Q |
215 |
taatct |
220 |
Q |
| |
|
|||||| |
|
|
| T |
49568 |
taatct |
49573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 176 - 220
Target Start/End: Complemental strand, 17805973 - 17805929
Alignment:
| Q |
176 |
aagatttcctctttcattgaaggaaaaaagcttaaaccctaatct |
220 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
17805973 |
aagatttcttctttcattgaatgaaaaaatcttaaaccctaatct |
17805929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University