View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_high_46 (Length: 233)
Name: NF15986_high_46
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 14247143 - 14246939
Alignment:
| Q |
18 |
atattaagaatgtgctgtatgcatattgacttttagatgaaattcttatgacattctttttccatgtatatggcaagcatt---ttacttgaccaatatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14247143 |
atattaagaatgtgctgtatgcatatcgacttttagatggaattcttatgacattctttttccatgtatatggcaagcattattttacttgaccaatatc |
14247044 |
T |
|
| Q |
115 |
tcatgtgatgtctgataaacattttcacaatcgctaacaattaatgtcgagtgatgaactcatatttcgataaacatgtaacgcttgatcagaaaaatac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14247043 |
tcatgtgatgtctgataaacattttcacaatcgctaacaattaatgtcgagtgatgaactcatatttcgataaacatgtaatgcttgatcagaaaaatac |
14246944 |
T |
|
| Q |
215 |
ctttg |
219 |
Q |
| |
|
||||| |
|
|
| T |
14246943 |
ctttg |
14246939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University