View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_high_55 (Length: 206)
Name: NF15986_high_55
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_high_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 14 - 190
Target Start/End: Complemental strand, 43178526 - 43178350
Alignment:
| Q |
14 |
aacctgtgttactgttaacgatgcacaaaggaaaggaacataagcattgctctcactcaccctttttcttccacaactcaacaattcaattcttagagct |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43178526 |
aacctgtgttactgttaactatgcacaaaggaaaggaacataagcattgctctcactcaccctttttcttccacaactcaacaattcaattcatagagct |
43178427 |
T |
|
| Q |
114 |
caaaacaaaaatcaaagtttagcataataataaccatgtcactgactatgtgtaccaccactagaggtcatctctag |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43178426 |
caaaacaaaaatcaaagtttagcataataataaccatgtcactgactatgtgtaccatcactagaggtcatctctag |
43178350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 100 - 165
Target Start/End: Complemental strand, 43172644 - 43172582
Alignment:
| Q |
100 |
caattcttagagctcaaaacaaaaatcaaagtttagcataataataaccatgtcactgactatgtg |
165 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
43172644 |
caattcatagagctcaaagcaaaaatcaaagttttgc---ataataaccatgtcactgactatgtg |
43172582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 63 - 133
Target Start/End: Complemental strand, 10883614 - 10883543
Alignment:
| Q |
63 |
ctctcactcaccctttttct-tccacaactcaacaattcaattcttagagctcaaaacaaaaatcaaagttt |
133 |
Q |
| |
|
||||||||||| |||| ||| |||||| |||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
10883614 |
ctctcactcactctttctctctccacagctcaacaattcaattcatagagctcaaaagaaaaatcaaagttt |
10883543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University