View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_low_19 (Length: 372)
Name: NF15986_low_19
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 358
Target Start/End: Original strand, 44910367 - 44910707
Alignment:
| Q |
19 |
cataggggacagggaatgtgaactagtatacgaaaagtatttgcatgaattatgcaactaaactgaaattcttgtcaataaacttctttcaccaactaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44910367 |
cataggggacagggaatgtgaactagtatacgaaaagtatttgcatgaatgatgcaactaaactgaaattcttgtcattaaacttctttcaccaactaag |
44910466 |
T |
|
| Q |
119 |
aatattatccacgaggtgtgagctcggtggtaagactttgactgtgcaactttgagagttcaaaacaccacgaggacttttgtaaaatggtcattggcgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910467 |
aatattatccacgaggtgtgagctcggtggtaagactttgactgtgcaactttgagagttcaaaacaccacgaggacttttgtaaaatggtcattggcgc |
44910566 |
T |
|
| Q |
219 |
cactttatttattgacaatttttctcttcctaa-nnnnnnnnnnnnnnnnnnncgttattatggcagaatctaaacaagaccccctgaatgagaatgtct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
44910567 |
cactttatttattgacaatttttctcttcctaattttttttttaaaaaaaaaacgttattatggcagaatctaaacaattccctctgaatgagaatgtct |
44910666 |
T |
|
| Q |
318 |
aagataatgcattttaatgcttgccaataacttttgatgac |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910667 |
aagataatgcattttaatgcttgccaataacttttgatgac |
44910707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University