View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_low_45 (Length: 244)
Name: NF15986_low_45
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_low_45 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 3686248 - 3686021
Alignment:
| Q |
16 |
ggactgagtgttgtgggaggtgattttggagcgctgtttattctgcttcttcgtcagataataagatattcgtttacaagatcaagttccctctgaagtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3686248 |
ggactgagtgttgtgggaggtgattttggagcgctgtttattctgcttcttcgtcagataataagatattcgtttacaagatcaagttccttctgaagtt |
3686149 |
T |
 |
| Q |
116 |
gcggacaaatgattgcaatggacgaagaatgaccaatagaagctttagcatttgaattctgcgctatcatttgatacattttctgccgaatctgaagcat |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3686148 |
gcagacaaatgattgcaatggacgaagaatgaccaatagaagctttaaca-ttgacttctgcgctatcatttgatacattttatgccgaatctgaagcat |
3686050 |
T |
 |
| Q |
216 |
ccatatgtgcattaacggttatcaattcc |
244 |
Q |
| |
|
|||||||| |||||||||||| ||||||| |
|
|
| T |
3686049 |
ccatatgttcattaacggttaccaattcc |
3686021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 75 - 125
Target Start/End: Original strand, 14144298 - 14144348
Alignment:
| Q |
75 |
aataagatattcgtttacaagatcaagttccctctgaagttgcggacaaat |
125 |
Q |
| |
|
||||||||||||| | ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
14144298 |
aataagatattcgctaacaagatcaagttccttttgaagttgcggacaaat |
14144348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University