View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_low_46 (Length: 239)
Name: NF15986_low_46
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 26217936 - 26217724
Alignment:
| Q |
14 |
atgaaagttccgcctctttaaaaatttaca--tatgaatgcaaaagaaactcgnnnnnnngaaattttaaaaacttcctatcatattttctgaagnnnnn |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26217936 |
atgaaagttccgcctctttaaaaatttacacatatgaaggcaaaagaaactcgtttttttgaaattttaaaaacttcctatcatattttctgaagaaaaa |
26217837 |
T |
|
| Q |
112 |
nnnn-ttactaggaaattttgctgggaaacaaatttactcgaaatatcaaattgcccccagaaacttaaagttaaaaaattaaaattcctcaagattttc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26217836 |
aaaaattactaggaaattttgctgggaaacaaatttactcgaaatatcaaattgcccccagaaacttaaagttaaaaagttaaaattcctcaagattttc |
26217737 |
T |
|
| Q |
211 |
tgagggaattttc |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26217736 |
tgagggaattttc |
26217724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University