View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_low_47 (Length: 239)
Name: NF15986_low_47
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 8022087 - 8021974
Alignment:
| Q |
1 |
tatgattgtatataggttaaaatttaggttaagttaccaacaatattttgtcaaagtggtaaggggtgtaaatcttttaagcatgtggtaataggtttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8022087 |
tatgattgtatataggttaaaatttaggttaagttaccaacaatattttgtcaaagtggtaaggggtgtaaatcttttaagcatgtggtaataggtttga |
8021988 |
T |
 |
| Q |
101 |
actctgccaccttc |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8021987 |
actctgccaccttc |
8021974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 120 - 223
Target Start/End: Complemental strand, 8021928 - 8021825
Alignment:
| Q |
120 |
ttcataggttctcttaattagattaattaccgctaaaactttgtatctataacttgtcaattgttttgaacagctaaatgaatttattaatgaggaacgt |
219 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8021928 |
ttcataggttctcttacttagattaattatcgctaaaactttgtatttataacttgtcaattgttttgaacagctaaatgaatttattaatgaggaacgt |
8021829 |
T |
 |
| Q |
220 |
atgt |
223 |
Q |
| |
|
|||| |
|
|
| T |
8021828 |
atgt |
8021825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University