View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15986_low_54 (Length: 222)
Name: NF15986_low_54
Description: NF15986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15986_low_54 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 61 - 204
Target Start/End: Original strand, 34769 - 34912
Alignment:
| Q |
61 |
tttggattgaaggccagtttttggaaaagttgtacagtagatgtgaatgtgactatgtggtttatgcagatggtgtgaatgttcctaaattgtagggacg |
160 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34769 |
tttggattgaaggcgagtgtttggaaaagttgtacagtagatgtgaatgtgactatgtggtttatgcagatggtgtgaatgttcctaaattgtagggagg |
34868 |
T |
 |
| Q |
161 |
agttagttcctttcaagtactttggtctctcgataaaggtgaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34869 |
agttagttcctttcaagtactttggtctctcgataaaggtgaat |
34912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University