View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15987_high_3 (Length: 375)
Name: NF15987_high_3
Description: NF15987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15987_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 114 - 357
Target Start/End: Complemental strand, 13034690 - 13034446
Alignment:
| Q |
114 |
agtactacggagtatttgcccgc--aacttattatcacccctcgaaccattggtaaatacgtcatgaatcccattaaataaaagctgcgctgaatacaac |
211 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13034690 |
agtactacggagtatttgcccccccaacttattatcacccctcgaaccattggtaaatacgtcatgaatcccattaaataaaagctgcgctgaatacaac |
13034591 |
T |
|
| Q |
212 |
tgcgttattatgtcatcaatatccctagtgccaaaattcaacaataaatagcttatgggctgcaatannnnnnnctcaacaatttgataatgccatcatg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
13034590 |
tgcgttattatgtcatcaatatccctagtgccaaaattcaacaataaatagcttatgtgctgcaata-ggggggctcaacaatttgataatggcatcatg |
13034492 |
T |
|
| Q |
312 |
aattaattttgacgttaaaataagttggagtagtttagggtgaaca |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13034491 |
aattaattttgacgttaaaataagttggagtagtttagggtgaaca |
13034446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 114 - 357
Target Start/End: Complemental strand, 13104663 - 13104419
Alignment:
| Q |
114 |
agtactacggagtatttgcccgc--aacttattatcacccctcgaaccattggtaaatacgtcatgaatcccattaaataaaagctgcgctgaatacaac |
211 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13104663 |
agtactacggagtatttgcccccccaacttattatcacccctcgaaccattggtaaatacgtcatgaatcccattaaataaaagctgcgctgaatacaac |
13104564 |
T |
|
| Q |
212 |
tgcgttattatgtcatcaatatccctagtgccaaaattcaacaataaatagcttatgggctgcaatannnnnnnctcaacaatttgataatgccatcatg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
13104563 |
tgcgttattatgtcatcaatatccctagtgccaaaattcaacaataaatagcttatgtgctgcaata-ggggggctcaacaatttgataatggcatcatg |
13104465 |
T |
|
| Q |
312 |
aattaattttgacgttaaaataagttggagtagtttagggtgaaca |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13104464 |
aattaattttgacgttaaaataagttggagtagtttagggtgaaca |
13104419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University