View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15988_low_10 (Length: 329)
Name: NF15988_low_10
Description: NF15988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15988_low_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 329
Target Start/End: Complemental strand, 42754828 - 42754500
Alignment:
| Q |
1 |
ctttaattgcataacgttttggtctgatacttataatttgaattacttgttttgctgcaaactattgttcagctggttgcactgaatctattttatattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42754828 |
ctttaattgcataacgttttggtctgatacttataatttgaattacttgttttgctgcaaactattgttcagctggttgcactgaatctattttatattt |
42754729 |
T |
 |
| Q |
101 |
atatctgttgttgtctgtttacagtcgtagttagtttgtaatttgtagtccgcagttatagttgagtctaacgttgttttatctctgtcttctataaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42754728 |
atatctgttgttgtctgtttacagtcgtagttagtttgtaatttgttttccgcagttatagttgagtctaatgttgttttatctctgtcttctataaata |
42754629 |
T |
 |
| Q |
201 |
cagaggtgtagaatgtgtttttctttccaaaaaatattcacaattatagttgagtctaatgttgttgtctgttttatctcagattttctctaagaaatcc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42754628 |
cagaggtgtagaatgtgtttttctttccaaaaaatattcacaattatagttgagtctaatgttgttgtctgttttatctcagattttctctcagaaatcc |
42754529 |
T |
 |
| Q |
301 |
tctctcttctcaattctcacactttcttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42754528 |
tctctcttctcaattctcacactttcttt |
42754500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University