View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15988_low_13 (Length: 313)
Name: NF15988_low_13
Description: NF15988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15988_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 19292336 - 19292050
Alignment:
| Q |
1 |
cttcactaaactctctcttgtctcatgttactaaaattgaaacttattgctcattttagtccctctttagattgaaaattgccctaattattgtttaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19292336 |
cttcactaaactctctcttgtctcatgttactaaaattgaaacttattgctcattttagtccctctttagattgaaaattgccctaattattgtttaatg |
19292237 |
T |
|
| Q |
101 |
ttatatattcaggaaatcgatcgcaaagcaagagaagattaaatagaaaggcaacctgcatgtcatgtagttactgcctaaagatttggcaacatagaat |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19292236 |
ttatatattcaggaa----atcgcaaagcaagagaagattaaatagaaaggcaacctgcatgtcatgtagttactgcctagagatttggcaacatagaat |
19292141 |
T |
|
| Q |
201 |
ttgcatttaggacatctcctccgtttattattcttagcagccgggcgcgtcaacataccatcttctttctccctcttgtccgcgttcagctt |
292 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| | ||||||||| |
|
|
| T |
19292140 |
ttgcatttaggacatctcctcagtttatt-ttcttagcagccgggcgcgtcaacataccatcttctttctccctcctgtcggtgttcagctt |
19292050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 182 - 292
Target Start/End: Complemental strand, 19270825 - 19270718
Alignment:
| Q |
182 |
agatttggcaacatagaatttgcatttaggacatctcctccgtttattattcttagcagccgggcgcgtcaacataccatcttctttctccctcttgtcc |
281 |
Q |
| |
|
||||||||||||||| | | ||||||||||||||| ||||| || |||| ||||||| ||||| |||||||| |||||||||||| ||||| |||| |
|
|
| T |
19270825 |
agatttggcaacataaattctgcatttaggacatcgcctccacttcttatccttagcaa---ggcgcatcaacataacatcttctttcttcctctcgtcc |
19270729 |
T |
|
| Q |
282 |
gcgttcagctt |
292 |
Q |
| |
|
||||||||||| |
|
|
| T |
19270728 |
gcgttcagctt |
19270718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University