View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15988_low_23 (Length: 233)
Name: NF15988_low_23
Description: NF15988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15988_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 29333767 - 29333569
Alignment:
| Q |
20 |
aacgtggattgaccttagactcgatgctgaaatagttggttttgaaatggtttacaccattcttgcaga-ctgatcgaagatacaatattgagtcttgtg |
118 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||| ||| | |||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
29333767 |
aacgtggatggaccttcgactcgatgctgaaatagttggttttgacatgagtgacaccattcttgcagaactgatggaagatacaatattgagtcttgtg |
29333668 |
T |
|
| Q |
119 |
agtctaagtacagaaagttgatgttttgtgtctcaatttgaattgaaggacagcaatagcggcattaacttgtagatgacaactcagaggaacctcatg |
217 |
Q |
| |
|
|||| |||||| ||||||| ||||| |||| |||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
29333667 |
agtcaaagtacggaaagttaatgttatgtgcttcaatttgaattgaaggacagcgagagcggcattaacttgtagatgacaaatcagaggaacatcatg |
29333569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 20 - 108
Target Start/End: Original strand, 29696912 - 29697001
Alignment:
| Q |
20 |
aacgtggattgaccttagactcgatgctgaaatagttggttttgaaatggtttacaccattcttgcag-actgatcgaagatacaatatt |
108 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29696912 |
aacgtggatggaccttagactcgatgctgaaatagctggttttgaaatgggtgacaccattcttgcagaactgatcgaagatacaatatt |
29697001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 151 - 217
Target Start/End: Original strand, 29697015 - 29697081
Alignment:
| Q |
151 |
tcaatttgaattgaaggacagcaatagcggcattaacttgtagatgacaactcagaggaacctcatg |
217 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
29697015 |
tcaatttgaattgaaggacagcgagagcggcattaacttgtagatgacaaatcagaggaacatcatg |
29697081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University