View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15988_low_25 (Length: 220)
Name: NF15988_low_25
Description: NF15988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15988_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 33049518 - 33049327
Alignment:
| Q |
18 |
gaatcgagagagtttcttctttcgttatcggaatccatcgcgtttcataaacttcctacgtttgagactattgctgttattacaaaagcgaaaggtgcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||| |||||||| |||||||||||||| | |
|
|
| T |
33049518 |
gaatcgagagagtttcttctttcgttatcggaatccatcgcgtttcataaacttcctaccttcgaaactattgcggttattactaaagcgaaaggtgcaa |
33049419 |
T |
|
| Q |
118 |
atgcgttttgttgggatgaacatagaggcttcttgtgttttgcaaggcagaagcgtgtttgtatcttcaaacgcgacggtaatttcatctca |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33049418 |
atgctttttgttgggatgaacatagaggcttcttgtgttttgcgaggcagaagcgtgtttgtatcttcagacgcgacggtaatttcatctca |
33049327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 136
Target Start/End: Original strand, 7674247 - 7674366
Alignment:
| Q |
17 |
agaatcgagagagtttcttctttcgttatcggaatccatcgcgtttcataaacttcctacgtttgagactattgctgttattacaaaagcgaaaggtgct |
116 |
Q |
| |
|
||||||||||||| ||||||| ||| | || ||||| ||||| ||||||| | | || | || || ||||| || |||||||| ||||| ||||| ||| |
|
|
| T |
7674247 |
agaatcgagagagcttcttctatcgctttctgaatcaatcgcttttcatagattaccaagtttggaaactatagcggttattacgaaagctaaaggagct |
7674346 |
T |
|
| Q |
117 |
aatgcgttttgttgggatga |
136 |
Q |
| |
|
|||| |||||| |||||||| |
|
|
| T |
7674347 |
aatgtgttttgctgggatga |
7674366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University