View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1598_high_11 (Length: 251)
Name: NF1598_high_11
Description: NF1598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1598_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 42521920 - 42521685
Alignment:
| Q |
1 |
tgatgaataatcttttccatctaaatgcatgcacgcatataaaggatatttggtaaatggattaaccacctgcaaaaataaaagtagcagacaataatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42521920 |
tgatgaataatcttttccatctaaatgcatgcacgcatataaaggatatttggtaaatggattaaccacctgcaaaaataaaagtagcagacaataatgt |
42521821 |
T |
 |
| Q |
101 |
tagaaatttatatggtttatatgtcatggtataatctgctaagaaaatatctgcaattaaatgtagaatcggtataccgtagtccagacagcaatcttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42521820 |
tagaaatttatatggtttatatgtcatggtataatctgctaagaaaatatctgcaattaaatgtagaatcggtataccgtagtccagacagcaatcttgg |
42521721 |
T |
 |
| Q |
201 |
ttgcaaccaagtcttgaggcaggttaagggtgaatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42521720 |
ttgcaaccaagtcttgaggcaggttaagggtgaatt |
42521685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 77
Target Start/End: Original strand, 19240886 - 19240925
Alignment:
| Q |
38 |
tataaaggatatttggtaaatggattaaccacctgcaaaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19240886 |
tataaaggatatttggtaaatggattaaccacctgcaaaa |
19240925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University