View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1598_low_15 (Length: 236)
Name: NF1598_low_15
Description: NF1598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1598_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 8928797 - 8929002
Alignment:
| Q |
19 |
cacgagcgctaggagcataaattgaaacttttccaattttaaatcgaagattggtttcaatacatcttttattttcagaatgacatctaagtggtcaagg |
118 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||| |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
8928797 |
cacgtgcgctaggagcataaattggaactttttcaattttaaatc-aagattggtttcaacacatcttttattttcagaatgatatctaagtggttaagg |
8928895 |
T |
 |
| Q |
119 |
aagttatcaaaagtatttccaaagagagataaattatccataagttttaaaa-cgccctgtcagtagactcaaaatcttcaaatactaaaaatatcgttt |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8928896 |
aagttatcaaaagtatttccaaagatagataaatcatccataagttttaaaaccgccctgtcagtagactcaaaatcttcaaatactaaaaatatcgttt |
8928995 |
T |
 |
| Q |
218 |
gacagaa |
224 |
Q |
| |
|
||||||| |
|
|
| T |
8928996 |
gacagaa |
8929002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University