View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1598_low_16 (Length: 236)
Name: NF1598_low_16
Description: NF1598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1598_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 32496960 - 32497033
Alignment:
| Q |
1 |
tttttaatttgttatttagaattagtttattaatgtctagcttctccttgatgtctttcttgctctcttgattc |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32496960 |
tttttaatttgttatttagaattagtttattaatgtctagcttctccttgatgtctttcttgctctcttgattc |
32497033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 144 - 190
Target Start/End: Original strand, 32497103 - 32497149
Alignment:
| Q |
144 |
gagataatttctatctctataatccatacgaggattcattaataaac |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32497103 |
gagataatttctatctctataatccatacgaagattcattaataaac |
32497149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 74
Target Start/End: Original strand, 30433921 - 30433961
Alignment:
| Q |
34 |
tgtctagcttctccttgatgtctttcttgctctcttgattc |
74 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30433921 |
tgtccagcttctccttgatgtctttcttgcgctcttgattc |
30433961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 74
Target Start/End: Complemental strand, 28299025 - 28298984
Alignment:
| Q |
33 |
atgtctagcttctccttgatgtctttcttgctctcttgattc |
74 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
28299025 |
atgtgtagcttctccttgatgccttccttgctctcttgattc |
28298984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 74
Target Start/End: Original strand, 28513048 - 28513089
Alignment:
| Q |
33 |
atgtctagcttctccttgatgtctttcttgctctcttgattc |
74 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
28513048 |
atgtgtagcttctccttgatgccttccttgctctcttgattc |
28513089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University