View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1598_low_16 (Length: 236)

Name: NF1598_low_16
Description: NF1598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1598_low_16
NF1598_low_16
[»] chr8 (3 HSPs)
chr8 (1-74)||(32496960-32497033)
chr8 (144-190)||(32497103-32497149)
chr8 (34-74)||(30433921-30433961)
[»] chr6 (2 HSPs)
chr6 (33-74)||(28298984-28299025)
chr6 (33-74)||(28513048-28513089)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 32496960 - 32497033
Alignment:
1 tttttaatttgttatttagaattagtttattaatgtctagcttctccttgatgtctttcttgctctcttgattc 74  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32496960 tttttaatttgttatttagaattagtttattaatgtctagcttctccttgatgtctttcttgctctcttgattc 32497033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 144 - 190
Target Start/End: Original strand, 32497103 - 32497149
Alignment:
144 gagataatttctatctctataatccatacgaggattcattaataaac 190  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||    
32497103 gagataatttctatctctataatccatacgaagattcattaataaac 32497149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 74
Target Start/End: Original strand, 30433921 - 30433961
Alignment:
34 tgtctagcttctccttgatgtctttcttgctctcttgattc 74  Q
    |||| ||||||||||||||||||||||||| ||||||||||    
30433921 tgtccagcttctccttgatgtctttcttgcgctcttgattc 30433961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 74
Target Start/End: Complemental strand, 28299025 - 28298984
Alignment:
33 atgtctagcttctccttgatgtctttcttgctctcttgattc 74  Q
    |||| |||||||||||||||| ||| ||||||||||||||||    
28299025 atgtgtagcttctccttgatgccttccttgctctcttgattc 28298984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 74
Target Start/End: Original strand, 28513048 - 28513089
Alignment:
33 atgtctagcttctccttgatgtctttcttgctctcttgattc 74  Q
    |||| |||||||||||||||| ||| ||||||||||||||||    
28513048 atgtgtagcttctccttgatgccttccttgctctcttgattc 28513089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University