View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1598_low_6 (Length: 383)

Name: NF1598_low_6
Description: NF1598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1598_low_6
NF1598_low_6
[»] chr4 (1 HSPs)
chr4 (312-360)||(54182775-54182823)
[»] chr6 (1 HSPs)
chr6 (321-365)||(2334441-2334485)


Alignment Details
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 312 - 360
Target Start/End: Complemental strand, 54182823 - 54182775
Alignment:
312 cttcacaaataactcttgattacaaagaaaaatcattaaatcagagaaa 360  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||    
54182823 cttcacagataactcttgattacaaagaaaaatcattaaatcagagaaa 54182775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 321 - 365
Target Start/End: Original strand, 2334441 - 2334485
Alignment:
321 taactcttgattacaaagaaaaatcattaaatcagagaaagtttt 365  Q
    ||||||||||||||||||||||| |||||||||||||||||||||    
2334441 taactcttgattacaaagaaaaaacattaaatcagagaaagtttt 2334485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University