View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1599-INSERTION-4 (Length: 343)
Name: NF1599-INSERTION-4
Description: NF1599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1599-INSERTION-4 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 8 - 343
Target Start/End: Complemental strand, 36871954 - 36871619
Alignment:
| Q |
8 |
ttcacttcctaacaaccttgtctcttcatgctttgatccatctcaatttgttgccacaccagacacatgtgctcaaattcaaaccaaacaagattggctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36871954 |
ttcacttcctaacaaccttgtctcttcatgctttgatccatctcaatttgttgccacaccagacacatgtgctcaaattcaaaccaaacaagattggctt |
36871855 |
T |
 |
| Q |
108 |
aacaaagttgattcaacagatttaactgttcttgataatgtttgtgaaccagatttaacagattcagatcattgtcatgtttgtaaaaatcaagggttta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36871854 |
aacaaagttgattcaacagatttaactgttcttgataatgtttgtgaaccagatttaacagattcggatcattgtcatgtttgtaaaaatcaagggttta |
36871755 |
T |
 |
| Q |
208 |
aggttcaacagatgctgcctaaatttgatggtaatagttcacattctcaagattgtttttattttacaatactatatatagctggaattgtgaataaact |
307 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36871754 |
aggttcaacagatgctgactaaatttgatggtaatagttcacattctcaagattgtttttattttacaatactatatatagctggaattgtgaataaact |
36871655 |
T |
 |
| Q |
308 |
tggtcctgagagtacaggtgttttggcttgcattct |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36871654 |
tggtcctgagagtacaggtgttttggcttgcattct |
36871619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University