View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1599-INSERTION-5 (Length: 388)
Name: NF1599-INSERTION-5
Description: NF1599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1599-INSERTION-5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 202 - 358
Target Start/End: Original strand, 11975395 - 11975551
Alignment:
| Q |
202 |
aacagtcatattgttggccacaagtttactacgtgtggttatgagtattgcacttgcaccattggatgtcattaatatcttgtccaaatcagagagcatc |
301 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11975395 |
aacagtaatattgttggccacaagtttactacgtgtggttatgagaattgcacttgcaccattggacgtcattaatatcttgtccaaatcagagagcatc |
11975494 |
T |
|
| Q |
302 |
tcatcaccaagtatcccagttttcaagttatccggcacaacaaggttgccttttccg |
358 |
Q |
| |
|
|| || ||||||||| |||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
11975495 |
tcgtccccaagtatctcagttttcaaattatccagcacaacaaggtttccttttccg |
11975551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 7 - 102
Target Start/End: Original strand, 11975257 - 11975352
Alignment:
| Q |
7 |
actattttgtcgaagaattttcgaaaacaatgacagagattcctcttcattaagccccaaaaagacatgtggcttaaacgtggtgaaaatagtatc |
102 |
Q |
| |
|
|||| |||||| | ||| |||| |||||||||||| ||||||||||||||||||||||| || |||||||||||||||||||| |||| |||||| |
|
|
| T |
11975257 |
actactttgtccacgaactttccaaaacaatgacaaagattcctcttcattaagccccagaataacatgtggcttaaacgtggtaaaaacagtatc |
11975352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University