View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15992_high_8 (Length: 344)
Name: NF15992_high_8
Description: NF15992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15992_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 208 - 335
Target Start/End: Original strand, 10103642 - 10103769
Alignment:
| Q |
208 |
tcttaaacttaacataagtttaatgttttatattagataatggagatacgcccaaatgtaaactggaataaaggtgatgctctaatgtattttcttgaca |
307 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10103642 |
tcttaaacttaacataagttgaatgttttatattagattatggagatacgcccaaatgtgaactggaataaaggcgatgctctaatgtattttcttgaca |
10103741 |
T |
 |
| Q |
308 |
ctcttggatataacacctttgatgatgt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10103742 |
ctcttggatataacacctttgatgatgt |
10103769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 17 - 84
Target Start/End: Original strand, 10103383 - 10103450
Alignment:
| Q |
17 |
attgttgagtctattatgaaagattaccctgattttctcatatcaggagggaaagaggtacaataatt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10103383 |
attgttgagtctattatgaaagattaccctgattttctcatatcaggagggaaagaggtacaataatt |
10103450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 10103515 - 10103559
Alignment:
| Q |
164 |
tgacagagaaaatgaaatatctctcttatttatctgtctttaaat |
208 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
10103515 |
tgacggagaaaatgaaatctctttcttatttatcagtctttaaat |
10103559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University