View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15993_high_11 (Length: 238)
Name: NF15993_high_11
Description: NF15993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15993_high_11 |
 |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0402 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0032 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 80 - 205
Target Start/End: Original strand, 23754 - 23879
Alignment:
| Q |
80 |
tgctctctcagggaagttccttttacccttgcacacttactttannnnnnnnnggtttgtttgacaattttgcatggtggaccatgctttgtgctagtgt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||| |||||||| | || ||||||||||||||||||| |
|
|
| T |
23754 |
tgctctctcagggaagttccttttacccttgcacacttattttattttttgttggtctgtttgacagttttgcattgcgggccatgctttgtgctagtgt |
23853 |
T |
 |
| Q |
180 |
gggggagggactacattttgttactt |
205 |
Q |
| |
|
|||||||||||| ||||||| |||| |
|
|
| T |
23854 |
gggggagggactgtattttgtcactt |
23879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 80 - 221
Target Start/End: Original strand, 31964134 - 31964273
Alignment:
| Q |
80 |
tgctctctcagggaagttccttttacccttgcacacttactttannnnnnnnnggtttgtttgacaattttgcatggtggaccatgctttgtgctagtgt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
31964134 |
tgctctctcagggaagttccttttacccttgcacacttattttatt-------ggcctgtttgacaattttgcattgcggactatgctttgtgctagtgt |
31964226 |
T |
 |
| Q |
180 |
ggg-----ggagggactacattttgttacttaatctctgttagtctt |
221 |
Q |
| |
|
||| |||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
31964227 |
ggggtggaggaggggctacattttgttacttaacctctattagtctt |
31964273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0402 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0402
Description:
Target: scaffold0402; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Complemental strand, 10855 - 10810
Alignment:
| Q |
176 |
gtgtgggggagggactacattttgttacttaatctctgttagtctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
10855 |
gtgtgggggagggactacattttgttacttaacctctgtttgtctt |
10810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University