View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15993_low_14 (Length: 230)
Name: NF15993_low_14
Description: NF15993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15993_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 4 - 213
Target Start/End: Original strand, 6127568 - 6127777
Alignment:
| Q |
4 |
acttggtcgattagaaaaccaacaaaattatagcgatgacgagtaatggatgagaaggagagaactagaagaaagac-----gggaacaaattgagtggt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
6127568 |
acttggtcgattagaaaaccaacaaaattatagcgatgaggagtaatggatgagaaggagagaa------gaaagacctagggggaacaaattgagtggt |
6127661 |
T |
 |
| Q |
99 |
ttaaaaataaaagtaccaccttttgacggaagaaataatttagagacttattcagaatgggaaacaaaaattgaacgaatttttgttgtaacacct-tat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
6127662 |
ttaaaaataaaagtaccaccttttgacggaagaaataattcagagacttatttagaatgggaaacaaaaatggaacgaatttttgttgtaacacctgtat |
6127761 |
T |
 |
| Q |
198 |
taacgttaaaaagatg |
213 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
6127762 |
taacgttaaaaagatg |
6127777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University