View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15994_low_9 (Length: 248)
Name: NF15994_low_9
Description: NF15994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15994_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 12 - 233
Target Start/End: Original strand, 56315293 - 56315513
Alignment:
| Q |
12 |
atgaacattaagaaggatttgaagcacgaagatcctttagctcatttttagtggcggagggtttaggtctttgatgaagaaggcggtgtctttaggcttc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
56315293 |
atgaacattaagaaggatttgaagcacgaagatcctttagctcatttttagtggcggagggtttaggtttttgatgaagaaggcggtgtctttaggcttc |
56315392 |
T |
|
| Q |
112 |
ttcaaagggtttatgcttccaaactcgaagagggtggtgtttggattgaaggttaatttcttcaatagtaggtttttggcgtaatgtttaggcgtatttt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
56315393 |
ttcaaagggtttatgcttccaaactcgaagaagatggtgtttggattgaaggttaatttcttcaatagtaggtttttggcgtaat-tttaggcgtatttt |
56315491 |
T |
|
| Q |
212 |
tgtgaaatgcggcaaacttttt |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
56315492 |
tgtgaaatgcggcaaacttttt |
56315513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University