View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15995_high_6 (Length: 222)
Name: NF15995_high_6
Description: NF15995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15995_high_6 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 114 - 222
Target Start/End: Original strand, 10193160 - 10193268
Alignment:
| Q |
114 |
acacggattggaaatttgacagaatatttaccaagcctaccggccatgtcagcacgctaaagtcaacactccgacagtttggaatcatattaactaagct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10193160 |
acacggattggaaatttgacagaatatttaccaagcctaccggccatgtcagcacgctaaagtcaacactccaacagtttggaatcatattaactaagct |
10193259 |
T |
 |
| Q |
214 |
tattccact |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
10193260 |
tattccact |
10193268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 36 - 115
Target Start/End: Original strand, 10192886 - 10192965
Alignment:
| Q |
36 |
agctagagcaaaatgaaggagttgaattctttgaatgagaaaatggtgaagttggccattcaaagcatagtagggcttac |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10192886 |
agctagagcaaaatgaaggagttgagttctttgaatgagaaaatggtgaagttggccattcaaagcatagtagggcttac |
10192965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 62 - 115
Target Start/End: Complemental strand, 19460668 - 19460615
Alignment:
| Q |
62 |
ttctttgaatgagaaaatggtgaagttggccattcaaagcatagtagggcttac |
115 |
Q |
| |
|
|||||||||||||| |||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
19460668 |
ttctttgaatgagagaatggtgaagttagacattcaaagcatggtagggcttac |
19460615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University