View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15995_low_1 (Length: 572)
Name: NF15995_low_1
Description: NF15995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15995_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 9e-50; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 9e-50
Query Start/End: Original strand, 445 - 553
Target Start/End: Complemental strand, 37212927 - 37212819
Alignment:
| Q |
445 |
tccatcaccatgaagcagagaacaagacctactttaccaaacaacttccacaaattcctgaaaccaggaaccctagctcgcctccgcgactcaaagataa |
544 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37212927 |
tccatcaccatgaagcagagaacaagacctactttaccaaaccacttccacaaattcctcaaaccaggaaccctagctcgcctccgcgactcaaagataa |
37212828 |
T |
|
| Q |
545 |
ccgccagat |
553 |
Q |
| |
|
||||||||| |
|
|
| T |
37212827 |
ccgccagat |
37212819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 13 - 131
Target Start/End: Complemental strand, 37213358 - 37213242
Alignment:
| Q |
13 |
aatatatgtattgaatcagtatattcaaaattttgcttcagttttaattgaactcttgttgatgaatgatatatgatagattttttagattaattattca |
112 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37213358 |
aatatctgtattgaatcagtatatttaaaattttgcttcaattttaattgaactcctgttgatgaatg--atatgatagattttttagattaattattca |
37213261 |
T |
|
| Q |
113 |
ttgaattagataccgagtt |
131 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
37213260 |
ttgaattagatatcgagtt |
37213242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 236 - 274
Target Start/End: Complemental strand, 37213134 - 37213096
Alignment:
| Q |
236 |
atcaagatcccgcctctatcccctagttttgttgttttt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37213134 |
atcaagatcccgcctctatcccctagttttgttgttttt |
37213096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University