View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15995_low_2 (Length: 261)
Name: NF15995_low_2
Description: NF15995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15995_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 24 - 256
Target Start/End: Original strand, 10049943 - 10050175
Alignment:
| Q |
24 |
gtaatttcttcttttttattgcttagctatgatgcgaattcgcgatatagatacctaaaatttatccaaccattgactgattcattcttatacaatgtat |
123 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10049943 |
gtaatttcttgttttttattgcttagctatgatgcaaattcgcgatttagatacctagaatttatccaaccattgactgattcattcttatacaatatat |
10050042 |
T |
|
| Q |
124 |
atttcacatattgtgttacatgcattatgtgcagctttagcactagtagacttgtaaagtttttgatgttgcaactattttataatatgttctatcagat |
223 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10050043 |
atttcacataatgtgttacatgcattatgtgcagctttagcactagtagacttgtaaagtttttgatgttgtaactattttataatatgttctatcagat |
10050142 |
T |
|
| Q |
224 |
tggatgcgcattggtgctttttcctttgcttct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
10050143 |
tggatgcgcattggtgctttttcctttgattct |
10050175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University