View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15995_low_3 (Length: 254)
Name: NF15995_low_3
Description: NF15995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15995_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 45037738 - 45037938
Alignment:
| Q |
1 |
ttcaatatgtcacagcaccttcagcagcttaaactgagctgttttttggtgaccattcattcgtgcaatggaagcaaaaacataaaaaatgaagtaagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037738 |
ttcaatatgtcacagcaccttcagcagcttaaactgagctgttttttggtgaccattcattcgtgcaatggaagcaaaaacataaaaaatgaagtaagga |
45037837 |
T |
|
| Q |
101 |
ataacgatggaaattattatggaagtgagtaaaaaagtttaggtgcaaccgttctagaannnnnnncaagaccaggggaaatggttggtgctatatttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
45037838 |
ataacgatggaaattattatggaagtgagt-aaaaagtttaggtgcaaccgttcaagaatttttttcaagacaaggggaaatggttggtgctatatttca |
45037936 |
T |
|
| Q |
201 |
gc |
202 |
Q |
| |
|
|| |
|
|
| T |
45037937 |
gc |
45037938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University