View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15995_low_5 (Length: 244)
Name: NF15995_low_5
Description: NF15995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15995_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 36057639 - 36057423
Alignment:
| Q |
18 |
ccttctgcaccctctcttcctcttgtacatggtgagatacaagttcatcgttgacggaacactattccagctaagtattgtagttcactttgaattaccc |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
36057639 |
ccttctgcaccctctcttcctcttgcacatggtgagatacaagttcatcgttgacggaacactattccggctaagtattgtagttcattttgaattaccc |
36057540 |
T |
|
| Q |
118 |
aaaatgtgtcgggagagaaatcaaaggcaagtgcacaatcaattcttcatgaaactctaacttcaatgtcttgagttttgatgcgagattagacatttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36057539 |
aaaatgtgtcgggagagaaatcaaagccaagtgcacaatcaattcttcatgaaactctaacttcaatgtcttgagttttgatgcgagattagacatttct |
36057440 |
T |
|
| Q |
218 |
ataagtactcccctatg |
234 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
36057439 |
ataagtactcccttatg |
36057423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 131 - 216
Target Start/End: Complemental strand, 28723826 - 28723741
Alignment:
| Q |
131 |
agagaaatcaaaggcaagtgcacaatcaattcttcatgaaactctaacttcaatgtcttgagttttgatgcgagattagacatttc |
216 |
Q |
| |
|
|||||||| ||| ||| |||||||| || |||||| ||| |||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
28723826 |
agagaaattaaaaccaaatgcacaattaaatcttcaggaagttctaacttcagtgccttgagttttgatgcgagattagacatttc |
28723741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 23070298 - 23070414
Alignment:
| Q |
102 |
tcactttgaattacccaaaatgtgtcgggagagaaatcaaaggcaagtgcacaatcaattcttcatgaaactctaacttcaatgtcttgagttttgatgc |
201 |
Q |
| |
|
|||||||||||| || || |||| ||||||||||||||| |||||||||||| || |||||| ||| ||||| ||| || ||||||||| | || |
|
|
| T |
23070298 |
tcactttgaattgtccgaagtgtggtgggagagaaatcaaaaccaagtgcacaattaaatcttcaagaagttctaaattccgtgccttgagtttgaaggc |
23070397 |
T |
|
| Q |
202 |
gagattagacatttcta |
218 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23070398 |
aagattagacatttcta |
23070414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University