View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15996_high_10 (Length: 277)
Name: NF15996_high_10
Description: NF15996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15996_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 37136751 - 37137006
Alignment:
| Q |
1 |
ttttactcctccaagtgattcacatgattaccaatactctgaaaatttgagctttgaacatcatggattcaatgcaggatctctgtatgattctgaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37136751 |
ttttactcctccaagtgattcacatgattaccaatactctgaaaatttgagctttgaacatcatggattcaatgcaggatctctgtatgattctaaaact |
37136850 |
T |
 |
| Q |
101 |
cctgcttcatcttatgctagtggagttgatggtaattttatgggaaattcaagcatggttaatgattactatgaagttgcaccattatcacatgatggaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136851 |
cctgcttcatcttatgctagtggcgttgatggtaattttatgggaaattcaagcatggttaatgattactatgaagttgcaccattatcacatgatggaa |
37136950 |
T |
 |
| Q |
201 |
aaaatagtggacttttggatgatcttgtgatggaaggtagaagtatttcttgcaat |
256 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136951 |
aaaatagtggacttttggacgatcttgtgatggaaggtagaagtatttcttgcaat |
37137006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University