View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15996_low_10 (Length: 277)
Name: NF15996_low_10
Description: NF15996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15996_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 37136775 - 37136506
Alignment:
| Q |
1 |
atgtgaatcacttggaggagtaaaattctggttgaaaagatttgatga---agatggataaggtgaaagtgaaggtgatttttgcaaagcaagagtttca |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136775 |
atgtgaatcacttggaggagtaaaattctggttgaaaagatttgatgatgaagatggataaggtgaaagtgaaggtgatttttgcaaagcaagagtttca |
37136676 |
T |
 |
| Q |
98 |
ttaatctcaatgttttcatcattggaaaagttgaattgtggacatggattggtgttgtgattattagcagaaccagagttgttctctagaagattataat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136675 |
ttaatctcaatgttttcatcattggaaaagttgaattgtggacatggattggtgttgtgattgttagcagaaccagagttgttctctagaagattataat |
37136576 |
T |
 |
| Q |
198 |
cataatggtttggatcatcaatcttcttagggtaacaagaagataagagtaaagaaaatgataatgatga |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37136575 |
cataatggtttggatcatcaatcttcttagggtaacaagaagataagagtaaagaaaatgataatgatga |
37136506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University