View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15996_low_13 (Length: 219)
Name: NF15996_low_13
Description: NF15996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15996_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 27852079 - 27852263
Alignment:
| Q |
18 |
tttttaaaccaactccaaaggcaagtatacatcataaacatgtgctgcatggcaagagtatcttgctgccaaatgatacaacattagtttaattcaatta |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27852079 |
tttttagaccaactccaaaggcaagtatacatcataaacatgtgctgcatggcaagagtatcttgctgccaaatgatacaacattagtttaattcaatta |
27852178 |
T |
 |
| Q |
118 |
ggtcatagagaaatgaattaaaactatatatagagtatacattagcctaactaaagaccattatataatcttatgcacaatttat |
202 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27852179 |
ggttataaagaaatgaattaaaactatatatagagtatacattagcctaactaaagaccattatataatcttatgcacaatttat |
27852263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University