View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15997_high_9 (Length: 210)
Name: NF15997_high_9
Description: NF15997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15997_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 142
Target Start/End: Complemental strand, 19293372 - 19293243
Alignment:
| Q |
13 |
acctgtgaaaactccaaagggaatatcttcatgttgttgagtcggatatatgtttctctgctgataacaaatgcatatgttgcagcctttgagtttagtg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19293372 |
acctgtgaaaactccaaagggaatatcttcatgttgttgagtcggatatatgtttctctgcttataacaaatgcatatgttgcagcctttgagtttagtg |
19293273 |
T |
|
| Q |
113 |
taggtacctccacatacgcaacaaaaacta |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19293272 |
taggtacctccacatacgcaacaaaaacta |
19293243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 194
Target Start/End: Complemental strand, 19292756 - 19292719
Alignment:
| Q |
157 |
agagataaacatcaactattgtcacaagaggaggatgt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19292756 |
agagataaacatcaactattgtcacaagaggtggatgt |
19292719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University