View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15997_low_10 (Length: 273)
Name: NF15997_low_10
Description: NF15997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15997_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 44 - 253
Target Start/End: Complemental strand, 22087741 - 22087532
Alignment:
| Q |
44 |
ataatatagtagactagagcaagaaaaaaggagtgtaaagaagaaaaaatttgttagtttctttttaaaatctgtgcaacagaagcagccaatttaatca |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22087741 |
ataatatagtagactagagcaagaaaaaaggagtgtaaagaagaaaaaatttgttagtttctttttaaaatctgtgcaacagaagcagccaatttaatca |
22087642 |
T |
|
| Q |
144 |
tacccttttgactattgcacccattatgtcttctaaggttccaaaacccgcaacatatccaacttgggacctcatcttctccaacttgtaggcatcattc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22087641 |
tacccttttgactattgcacccattatgtcttctaaggttccaaaaccctcaacatatccaacttgggacctcatcttctccaacttgtaggcatcattc |
22087542 |
T |
|
| Q |
244 |
gagttgactt |
253 |
Q |
| |
|
|||||||||| |
|
|
| T |
22087541 |
gagttgactt |
22087532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University