View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15997_low_13 (Length: 210)

Name: NF15997_low_13
Description: NF15997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15997_low_13
NF15997_low_13
[»] chr2 (2 HSPs)
chr2 (13-142)||(19293243-19293372)
chr2 (157-194)||(19292719-19292756)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 13 - 142
Target Start/End: Complemental strand, 19293372 - 19293243
Alignment:
13 acctgtgaaaactccaaagggaatatcttcatgttgttgagtcggatatatgtttctctgctgataacaaatgcatatgttgcagcctttgagtttagtg 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
19293372 acctgtgaaaactccaaagggaatatcttcatgttgttgagtcggatatatgtttctctgcttataacaaatgcatatgttgcagcctttgagtttagtg 19293273  T
113 taggtacctccacatacgcaacaaaaacta 142  Q
    ||||||||||||||||||||||||||||||    
19293272 taggtacctccacatacgcaacaaaaacta 19293243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 194
Target Start/End: Complemental strand, 19292756 - 19292719
Alignment:
157 agagataaacatcaactattgtcacaagaggaggatgt 194  Q
    ||||||||||||||||||||||||||||||| ||||||    
19292756 agagataaacatcaactattgtcacaagaggtggatgt 19292719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University